WASHINGTON, DC, 08:22 AM, TUE NOVEMBER 10 | Advertise on Wonkette | tips@wonkette.com | SUBMIT A TIP | RSS
CAUGHT IT FROM THE TELEPROMPTER

Administration Aide Has Pig AIDS

Fuck you Choo ChooWe should have known. We should have known that Barack Obama would try to kill us via that Red Chinese nerd queer, the energy secretary “Choo Choo,” who’s so dumb and violent that he doesn’t even know what oil is. This Energy Department aide of his went down to Mexico a couple of weeks ago to set the table for Obama’s visit, and he just had to fuck a pig while he was there, and then he got the disease and tried to kill his whole family with it, in Maryland.

An Energy Department employee who was part of the security advance team for President Obama’s recent trip to Mexico is suspected of having contracted the swine flu virus and transmitting it to his family in Anne Arundel County, the White House said today.

The man is on the staff of Energy Secretary Steven Chu, who traveled with Obama to Mexico on April 16. He is believed to have transmitted the highly contagious virus to his wife, son and nephew, press secretary Robert Gibbs said. The woman and young boys appear to be the three Anne Arundel County residents who, official said yesterday, have tested positive as “probable” victims of the virus.

And the band played on. But where in Anne Arundel County? The tiny hamlet of Severna Park, it so happens! Your editor went to school for many years in Severna Park, and, well, that place could use a bit of “cleansing,” so maybe this could be a bit of a windfall. (DID YOU KNOW THAT PAT SAJAK LIVES IN SEVERNA PARK? IT’S TRUE.)

But that liar Robert Gibbs says Obama does not have the pig flu, even though he has been in the same room as Choo Choo’s idiot minion. Obviously! Obama has the secret vaccine and will not release it to anyone else, *duh.*

Administration Aide Suspected of Contracting Swine Flu [WP]


3:46 PM on Thu April 30 2009
By Jim Newell
4407 Views

  1. ManchuCandidate says at 3:50 pm, April 30th, 2009

    No, it’s the Prez’s secret Muslin Terrorist blood. Any sort of swine DNA is forbidden in his system.

  2. chascates says at 3:51 pm, April 30th, 2009

    SEVERNA PARK? That sounds made up.

  3. snideinplainsight says at 3:51 pm, April 30th, 2009

    It’s all because Joe Biden has been weaponized. Weaponized! And the MSM refuses to admit it!

  4. InsidiousTuna says at 3:53 pm, April 30th, 2009

    Diseases are for bitches. As such, Hopey and his brood won’t get it.

  5. Johnny Zhivago says at 3:53 pm, April 30th, 2009

    So having sex with a pig is how this thing gets transmitted? I guess that explains why it’s such a problem in Mexico, I’d be nervous if I was a Republican, too.

  6. 4tehlulz says at 3:54 pm, April 30th, 2009

    YOU FOOLS! It was OBAMA that infected HIM! Because he secretly hates Mexicans, and Maryland.

  7. OK, let’s give him some Ritalin. That’s the solution to everything.

  8. Johnny Zhivago says at 3:54 pm, April 30th, 2009

    snideinplainsight: Binden’s TONGUE is weaponized - it’s a WSD (weapon of self destruction)

  9. FINALLY! Alt text I can believe in!!

  10. One Yield Regular says at 3:56 pm, April 30th, 2009

    For whatever it’s worth, I once sat across from Pat Sajak in a restaurant, and he was eating with his HANDS - a sure way of contracting swine flu if ever there was one.

  11. chascates says at 3:56 pm, April 30th, 2009

    The Fort Worth, Tex., school system closed its 80,000-student district for 10 days after confirmation of one case of swine flu at one campus and the announcement that there are probable cases at three other schools.
    And this flu is supposed to be milder than the regular flu! Have we become a nation of muslin-worshipping socialist pussies?

  12. What swine flu looks like!

    >gi|5764318|gb|AF153233.1|AF153233 Influenza A virus (A/Swine/Texas/4199-2/98 (H3N2)) hemagglutinin gene, partial cds
    AGCAAAAGCAGGGGATAATTCTATTAACCATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGT
    TTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCA
    AACGGAACCCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGA
    GTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACATTGATAGA
    TGCTCTACTGGGAGACCCTCATTGCGATGGCTTTCAAAATAAGGAATGGGACCTTTTTATTGAACGCAGC
    AAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATTCCTCCCTTAGGTCACTAGTTGCCTCAT
    CAGGCACCCTGGAGTTTACCAATGAAGACTTCAATTGGACTGGGGTCGCTCAGGATGGGGGAAGCTATTC
    TTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTACACAAATTAGAATACAAATAT
    CCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACC
    CGAGCACGGACAGTGAACAAACCAGCCTGTATGTTCAAGCAATAGGGAGAGTCACAGTCTCTACCAAAAG
    TAGCCAACAAACTGTAATCCCGAACATCGGGTCCAGACCCTGGGTGAGGGGCATCTCCAGTAGAATAAGC
    ATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAGCAGCACAGGGAATCTAATTGCTCCTC
    GGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCTA
    TTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAATAGGATCACA
    TATGGGGCCTGTCCCAAATATGTTAAGCAAAAAACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAG
    AGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGA
    CGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACCCAA
    GCAGCAATCGATCAAGTCAACGGGAAATTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAA
    TCGAAAAAGAATTTTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTG

  13. If the new NASA director had been appointed, or the F-22 had been approved, this would have never happened.

  14. pat robertsons personal trainer says at 3:57 pm, April 30th, 2009

    wAKE up sheeple. it’s beginning. and no matter what those communists tell you, DO NOT get the vaccine. it will make you good white christians sterile (or worse, have half-breed muslin babies).

  15. 2druk2phluq says at 3:57 pm, April 30th, 2009

    Crab1: I think you need to hear this.

    Crab1: FAIL!

  16. DangerousLiberal says at 3:59 pm, April 30th, 2009

    Everyone, it’s time to panic. Watch CNN, and then totally freak out.

    Visit http://doihavetheswineflu.com/ and await further instructions from your Muslin Overlords, who are now calling it H1N1(tm) because swine are dirty beasts (I learned that from Pulp Fiction).

  17. smartypants says at 4:00 pm, April 30th, 2009

    Is that LIPSTICK?????

  18. forgracie says at 4:01 pm, April 30th, 2009

    Rep. Barton’s revenge!!!

  19. Hooray For Anything says at 4:01 pm, April 30th, 2009

    According to the WingNuts (and Glenn Beck), this whole Swine Flu thing is just something ginned up by the NoBama administration to scare people into buying into Socialist, Government Health Care. In which case, I applaud the Obama for being so committed to anti-freedom health care that they sacrificed a staff member and his family for the Socialist Fascist Cause

  20. The Legend of TeaBagger Vance says at 4:03 pm, April 30th, 2009

    that swine-flu pig bears a striking resemblance to K-LO Goldberg.

  21. Nerdalicious says at 4:04 pm, April 30th, 2009

    Crab1:
    Ha! I wrote about this last night about 3am, some chick wrote a song for the pig/bird flu! True! She is matching notes to the amino acids in the flu! They had audio and everything to it on Cnn. Screaming laughing! “Love Song For The Flu” WTF??????????????
    http://www.cnn.com/2009/HEALTH/04/29/swine.flu.song.music/index.html

  22. Nerdalicious says at 4:05 pm, April 30th, 2009

    Hooray For Anything:
    That’s it get the darn straight jackets out. I’ve had it with the lot of them.

  23. Nerdalicious says at 4:08 pm, April 30th, 2009

    Hooray For Anything:
    The crazies are veering into Jerry Falwell aids loony territory. Not that they haven’t before. Well, at least 10 times a day. You think they would have learned after Spector left them in the dust. Don’t think Spector will be the first!

  24. snideinplainsight says at 4:09 pm, April 30th, 2009

    SOME PIG
    TERRIFIC
    RADIANT
    HUMBLE

    Sorry, I thought this thread was about Biden -

  25. jgrn307 says at 4:09 pm, April 30th, 2009

    some right-wing retard i used to go to high school with is on facebook arguing with me that because obama isn’t reading right-wing blogs (e.g. http://corner.nationalreview.com/post/?q=YmM0MTAzMWQzYzIxMTZmMjc1MjBmNGUzMDIyYTVhZDM=) for feedback on how to handle the swine flu epidemic, he is hypocritical because he is breaking his promise to put science before policy.

    never mind that the scientists at the CDC and the WHO are telling him “don’t close the borders”, those aren’t the RIGHT types of scientists. you know, the ones who don’t think evolution is real (I guess God had stored this flu virus in some ice cube underneath mexico waiting to be released)

  26. sham69 says at 4:11 pm, April 30th, 2009

    Severna Park, eh? Well it’s better than Glen Burnie. I grew up in Hillsmere Shores, so Severna Park seems like the Riviera to me.

  27. trondant says at 4:13 pm, April 30th, 2009

    Crab1: I loved Ethan Hawke in that one.

  28. Crab1: Correction.

    5th line, 3rd G should be a T. But I don’t want to give the antidote away until my patent comes through in 2-3 years.

  29. Mustang says at 4:16 pm, April 30th, 2009

    pat robertsons personal trainer: Sterile works for me.

  30. Czn939 says at 4:18 pm, April 30th, 2009

    Nerdalicious:
    Sounds like the soundtrack for some David Lynch movie.

  31. Czn939 says at 4:19 pm, April 30th, 2009

    Next up….
    Vocaloid Hatsune Miku sings Stephan Zielinski’s
    “Swine Flu”
    They SO need to do that!

  32. choinski says at 4:20 pm, April 30th, 2009

    Remember, its not PIG AIDS it MEXICAN AIDS. Now all you poindexrters figure out how it managed to jump from Mexicans to Humans.

  33. rachelv says at 4:20 pm, April 30th, 2009

    http://www.christiananswers.net/spotlight/movies/discernment/hollywood-america.html

    this article offers some very important clues as to why Obama decided to target Severna Park…

  34. Come here a minute says at 4:21 pm, April 30th, 2009

    jgrn307: No, you moran, Jesus Intelligent-Designed the virus to smite, SMITE I say, the muslin terrist in the White House and the libruls who voted for him.

  35. Johnny Zhivago says at 4:22 pm, April 30th, 2009

    pat robertsons personal trainer: Bull! The vacine will implant an alien tracking device in your arm though.

  36. Studge says at 4:23 pm, April 30th, 2009

    Crab1: Yes, but what does it FEEL like?

  37. zenferret says at 4:24 pm, April 30th, 2009

    Crab1: Hey that is the old H3N2 shit. The new shit H1N1 is cooler!

    A/Texas/05/2009
    1 atgaaggcaa tactagtagt tctgctatat acatttgcaa ccgcaaatgc agacacatta
    61 tgtataggtt atcatgcgaa caattcaaca gacactgtag acacagtact agaaaagaat
    121 gtaacagtaa cacactctgt taaccttcta gaagacaagc ataacgggaa actatgcaaa
    181 ctaagagggg tagccccatt gcatttgggt aaatgtaaca ttgctggctg gatcctggga
    241 aatccagagt gtgaatcact ctccacagca agctcatggt cctacattgt ggaaacatct
    301 agttcagaca atggaacgtg ttacccagga gatttcatcg attatgagga gctaagagag
    361 caattgagct cagtgtcatc atttgaaagg tttgagatat tccccaagac aagttcatgg
    421 cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc ctcatgctgg agcaaaaagc
    481 ttctacaaaa atttaatatg gctagttaaa aaaggaaatt catacccaaa gctcagcaaa
    541 tcctacatta atgataaagg gaaagaagtc ctcgtgctat ggggcattca ccatccatct
    601 actagtgctg accaacaaag tctctatcag aatgcagatg catatgtttt tgtggggtca
    661 tcaagataca gcaagaagtt caagccggaa atagcaataa gacccaaagt gagggatcaa
    721 gaagggagaa tgaactatta ctggacacta gtagagccgg gagacaaaat aacattcgaa
    781 gcaactggaa atctagtggt accgagatat gcattcgcaa tggaaagaaa tgctggatct
    841 ggtattatca tttcagatac accagtccac gattgcaata caacttgtca gacacccaag
    901 ggtgctataa acaccagcct cccatttcag aatatacatc cgatcacaat tggaaaatgt
    961 ccaaaatatg taaaaagcac aaaattgaga ctggccacag gattgaggaa tgtcccgtct
    1021 attcaatcta gaggcctatt tggggccatt gccggtttca ttgaaggggg gtggacaggg
    1081 atggtagatg gatggtacgg ttatcaccat caaaatgagc aggggtcagg atatgcagcc
    1141 gacctgaaga gcacacagaa tgccattgac gaaattacta acaaagtaaa ttctgttatt
    1201 gaaaagatga atacacagtt cacagcagta ggtaaagagt tcaaccacct ggaaaaaaga
    1261 atagagaatt taaataaaaa agttgatgat ggtttcctgg acatttggac ttacaatgcc
    1321 gaactgttgg ttctattgga aaatgaaaga actttggact accacgattc aaatgtgaag
    1381 aacttatatg aaaaggtaag aagccagcta aaaaacaatg ccaaggaaat tggaaacggc
    1441 tgctttgaat tttaccacaa atgcgataac acgtgcatgg aaagtgtcaa aaatgggact
    1501 tatgactacc caaaatactc agaggaagca aaattaaaca gagaagaaat agatggggta
    1561 aaactggaat caacaaggat ttaccagatt ttggcgatct attcaactgt cgccagttca
    1621 ttggtactgg tagtctccct gggggcaatc agtttctgga tgtgctctaa tgggtctcta
    1681 cagtgtagaa tatgtattta a

    I could even even figger out which dead pile of bones in the Texas desert that came from…

    (I work at NCBI/NLM/NIH doing software for the archives of all genetic stuff)

  38. Czn939 says at 4:26 pm, April 30th, 2009

    choinski:
    It’s my personal opinion that Pat Sajak has no soul.
    He traded it to the devil some 30 yrs ago in exchange for eternal
    youth.
    I’m 27 years old and that fucker hasn’t aged a DAY since I was born!
    Either that or they have a successive series of Pat Sajak clones,
    whereby this would be their 27th Iteration.

  39. Custerwolf says at 4:26 pm, April 30th, 2009

    zenferret: Wait a minute - that looks like the part of the script of Reefer Madness where the dude is totally fried and laughing demonically.

  40. Custerwolf says at 4:27 pm, April 30th, 2009

    Why is Lou Dobbs being so quiet on this?

  41. Canmon (the Inadequate) says at 4:34 pm, April 30th, 2009

    This could have been prevented if Obama had just paid attention to his daily briefing entitled “Mexican Swine Flu Virus Determined to strike U.S.”

  42. You guys, Severna Park is not nearly as awesome and cool as Yuzhna Park, you guys.

  43. chascates says at 4:36 pm, April 30th, 2009

    Pig Flu check:
    http://www.doihavepigflu.com

    Custerwolf: He’s not!:
    Dobbs refers to people who use the term “H1N1″ as “out of their cotton pickin’ minds”
    http://mediamatters.org/items/200904300015?f=h_top

  44. Bronkers says at 4:37 pm, April 30th, 2009

    zenferret: Try reading it aloud and you sound like a percussionist vocalizing.

    Or someone getting waterboarded.

  45. zenferret says at 4:37 pm, April 30th, 2009

    Nerdalicious: I had to share that with my cow-orkers. We see those sequences all day long as data.

    Thanks.

  46. The Cold Sea says at 4:41 pm, April 30th, 2009

    WHAY ARE THEY LYING/111

    Gibbs said the administration employee also was tested for the virus but the results were negative, likely because he had already recovered completely by the time he underwent the tests. He has returned to work, Gibbs said, and his relatives also suffered only mild symptoms and have regained their health.

  47. slithytoves says at 4:43 pm, April 30th, 2009
  48. BlueStateLibtard says at 4:44 pm, April 30th, 2009

    Odds of 3-5 that this was all masterminded by Dick Cheney, and the cure for pig flu will magically appear when the POTUS next-in command is some junior undersecretary in the Agriculture Department, who happens also to be the lone conservative in the entire Obama administration. While you libtards have all been laughing at Cheney for the last eight years about his “undisclosed” location, he’s been holed-up in some top-secret bio-lab creating the pig virus and his masterful plan. Did you think he was gonna just sit back and let the country go Obama??? Jokes on you again libtards!

  49. pat robertsons personal trainer says at 4:45 pm, April 30th, 2009

    some poor kid in Cairo is crying his eyes out because this announcement came a day late and dollar short for his recently murdered best friend in the whole world, wilbur II.
    http://www.chron.com/disp/story.mpl/ap/world/6401547.html

    in kinda seriousness, wtf WHO? people already really like to kill pigs. don’t make it harder on the non-pork product piggies who are doing nothing wrong by naming a “shit-yourself-with-fear” disease after the poor little bastards.

  50. chascates says at 4:45 pm, April 30th, 2009

    Custerwolf: Nerdalicious: So far as waiting out the oncoming crash of civilization may I suggest:
    Hanson Island, British Columbia
    http://www.privateislandsonline.com/bchanson.htm

  51. One Yield Regular says at 4:48 pm, April 30th, 2009

    zenferret: Tell your bosses to give us more R01’s, dammit.

  52. Jukesgrrl says at 4:49 pm, April 30th, 2009

    When is this flu going to get on a motorcycle and ride off to Alaska? The residents of Wasilla are eager to pass it around to each other. Then they will freeze it so it will last forever.

  53. zenferret says at 4:54 pm, April 30th, 2009

    One Yield Regular: I’m bottom rung contract software engineer. My bosses barely know I’m alive. No one who has anything to do with R01s knows me.

    But that shiny new Democrat / creaky old republican got us more moneys in teh stimulus. Maybe they’ll give some to you.

    As long as they keep giving some to me I’m happy. Well happier than if they didn’t.

  54. zenferret says at 4:54 pm, April 30th, 2009

    Jukesgrrl: piggy virus on meth.

  55. bitchincamaro says at 4:58 pm, April 30th, 2009

    choinski: How do we know those catlick school kids didn’t give it to the Mexicans? Don’t wait for a punchline.

  56. Lascauxcaveman says at 5:00 pm, April 30th, 2009

    Severna Park? Really? What a co-inkydinky. That’s the name of my Hungarian-Korean dominatrix.

  57. sati demise says at 5:01 pm, April 30th, 2009

    choinski: wrong.
    This is officially the ‘Smithfield Swine Flue”

    Corporate sponsorship is important you know.

    http://www.guardian.co.uk/world/2009/apr/27/swine-flue-search-outbreak-source

  58. WadISay says at 5:03 pm, April 30th, 2009

    Johnny Zhivago: “Swine flu! Look, Muffy, a flu for us!”

  59. Nerdalicious says at 5:03 pm, April 30th, 2009

    chascates:
    Kewl! Does Brangelina hang out there? Let’s go after our flu trip to NYC!

  60. Nerdalicious says at 5:05 pm, April 30th, 2009

    zenferret:
    Ha! I think that just might be the wackiest thing to come out of this yet, that Flu Song.

  61. Nerdalicious says at 5:06 pm, April 30th, 2009

    Czn939:
    Yeah David Lynch, do the amino acids talk backwards????????

  62. Nerdalicious says at 5:11 pm, April 30th, 2009

    Ok, I wrote this late last night about the Flu Song:
    “Pig/Bird Flu, How Do I Love Thee, May I Count The Ways”

    “The breadth & depth, of your untamed cells furrowing into my marrow.
    How I wish I could quit you with a vaccine.
    But, nay there is none, only thee
    And even the Prez said I have to wash my hands of you.
    I weep.
    The only respite is Tammy Flu.
    But, I want you.
    Waterfalls of tears
    And nasal mucous.
    Fini.”

    I find this as amusing as when all those aortic valves of famous people just went Pffffft all at once, Babs Bush, Robin Williams and some baseball player. Soylent Green is aortic valves!

  63. smartypants says at 5:12 pm, April 30th, 2009
  64. Nerdalicious says at 5:12 pm, April 30th, 2009

    WadISay:
    Good One!Ok everyone! Flu Song Contest! Yearrrrrrrrrgggggghhhhhh!

  65. smartypants says at 5:14 pm, April 30th, 2009

    Custerwolf: You know what that’s a damn good question.

    Lucifer Dobbs is obviously the epicenter of this entire Agent 666/HNIC Virus debacle.

  66. mrpuma2u says at 5:23 pm, April 30th, 2009

    Custerwolf: He has sequesterd himself in his dressing room which he has sealed off with duck and cover tape and insaranity wrap and won’t come out.

  67. DoctorCulturae says at 5:24 pm, April 30th, 2009

    Custerwolf: The hyper-revealing tell! Dobbs is the litmus test. One smelleth le odeur du swine in the business ointment.

  68. teh_bad_dr says at 5:28 pm, April 30th, 2009

    zenferret: Crab1 also.

    Single letter amino acid code please. You guys are so CSH Guide to Molecular Biology Version 1.

  69. Jukesgrrl says at 5:31 pm, April 30th, 2009

    zenferret: “piggy virus on meth” I think I was in a band once that had that name.

  70. Hey! That’s, like, down the road from me!

    *Starts stockpiling food.*

  71. sux2bu says at 5:45 pm, April 30th, 2009

    Hopey is, in reality, the dreaded Patient Zero! He’ll give all of us that muslin pig virus if he’s not stopped!

  72. Nerdalicious says at 6:08 pm, April 30th, 2009

    sux2bu:
    Believe me that will be the next Rethug angle! Then they will lose another Spector & it will be a domino effect. Bachman, Palin, & Limbaugh will be like “Lost” survivors.

  73. funkyj says at 6:50 pm, April 30th, 2009

    From the article “”"Neither the president nor Chu experienced any symptoms of the virus, Gibbs said, and White House doctors do not think Obama should be tested. “”" CONSPIRACY!!! Are they afraid the swine flu test will also reveal the fake prenzidnet’s bogus somalie origin? If he doesn’t have the pig flu why is he so afraid to take the test?

  74. One Yield Regular says at 7:02 pm, April 30th, 2009

    zenferret: Well thanks anyway. Actually, everyone I know in science is pretty happy about the monies at the moment, especially after the past 8 of fundamentalism.

  75. One Yield Regular says at 7:04 pm, April 30th, 2009

    Uh…8 YEARS. Sorry.

  76. Accordion-o-rama says at 7:48 pm, April 30th, 2009

    zenferret: Set sequencers on stun.

  77. mylesfromnowhere says at 10:27 pm, April 30th, 2009

    he gets weekly injections of plasma directly from Dick Clark.

Leave a Reply