Wonkette
We should have known. We should have known that Barack Obama would try to kill us via that Red Chinese nerd queer, the energy secretary “Choo Choo,” who’s so dumb and violent that he doesn’t even know what oil is. This Energy Department aide of his went down to Mexico a couple of weeks ago to set the table for Obama’s visit, and he just had to fuck a pig while he was there, and then he got the disease and tried to kill his whole family with it, in Maryland.
An Energy Department employee who was part of the security advance team for President Obama’s recent trip to Mexico is suspected of having contracted the swine flu virus and transmitting it to his family in Anne Arundel County, the White House said today.
The man is on the staff of Energy Secretary Steven Chu, who traveled with Obama to Mexico on April 16. He is believed to have transmitted the highly contagious virus to his wife, son and nephew, press secretary Robert Gibbs said. The woman and young boys appear to be the three Anne Arundel County residents who, official said yesterday, have tested positive as “probable” victims of the virus.
And the band played on. But where in Anne Arundel County? The tiny hamlet of Severna Park, it so happens! Your editor went to school for many years in Severna Park, and, well, that place could use a bit of “cleansing,” so maybe this could be a bit of a windfall. (DID YOU KNOW THAT PAT SAJAK LIVES IN SEVERNA PARK? IT’S TRUE.)
But that liar Robert Gibbs says Obama does not have the pig flu, even though he has been in the same room as Choo Choo’s idiot minion. Obviously! Obama has the secret vaccine and will not release it to anyone else, *duh.*
Administration Aide Suspected of Contracting Swine Flu [WP]
No, it’s the Prez’s secret Muslin Terrorist blood. Any sort of swine DNA is forbidden in his system.
SEVERNA PARK? That sounds made up.
It’s all because Joe Biden has been weaponized. Weaponized! And the MSM refuses to admit it!
Diseases are for bitches. As such, Hopey and his brood won’t get it.
So having sex with a pig is how this thing gets transmitted? I guess that explains why it’s such a problem in Mexico, I’d be nervous if I was a Republican, too.
YOU FOOLS! It was OBAMA that infected HIM! Because he secretly hates Mexicans, and Maryland.
OK, let’s give him some Ritalin. That’s the solution to everything.
snideinplainsight: Binden’s TONGUE is weaponized - it’s a WSD (weapon of self destruction)
FINALLY! Alt text I can believe in!!
For whatever it’s worth, I once sat across from Pat Sajak in a restaurant, and he was eating with his HANDS - a sure way of contracting swine flu if ever there was one.
The Fort Worth, Tex., school system closed its 80,000-student district for 10 days after confirmation of one case of swine flu at one campus and the announcement that there are probable cases at three other schools.
And this flu is supposed to be milder than the regular flu! Have we become a nation of muslin-worshipping socialist pussies?
What swine flu looks like!
>gi|5764318|gb|AF153233.1|AF153233 Influenza A virus (A/Swine/Texas/4199-2/98 (H3N2)) hemagglutinin gene, partial cds
AGCAAAAGCAGGGGATAATTCTATTAACCATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGT
TTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCA
AACGGAACCCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGA
GTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACATTGATAGA
TGCTCTACTGGGAGACCCTCATTGCGATGGCTTTCAAAATAAGGAATGGGACCTTTTTATTGAACGCAGC
AAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATTCCTCCCTTAGGTCACTAGTTGCCTCAT
CAGGCACCCTGGAGTTTACCAATGAAGACTTCAATTGGACTGGGGTCGCTCAGGATGGGGGAAGCTATTC
TTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTACACAAATTAGAATACAAATAT
CCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACC
CGAGCACGGACAGTGAACAAACCAGCCTGTATGTTCAAGCAATAGGGAGAGTCACAGTCTCTACCAAAAG
TAGCCAACAAACTGTAATCCCGAACATCGGGTCCAGACCCTGGGTGAGGGGCATCTCCAGTAGAATAAGC
ATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAGCAGCACAGGGAATCTAATTGCTCCTC
GGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCTA
TTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAATAGGATCACA
TATGGGGCCTGTCCCAAATATGTTAAGCAAAAAACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAG
AGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGA
CGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACCCAA
GCAGCAATCGATCAAGTCAACGGGAAATTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAA
TCGAAAAAGAATTTTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTG
If the new NASA director had been appointed, or the F-22 had been approved, this would have never happened.
wAKE up sheeple. it’s beginning. and no matter what those communists tell you, DO NOT get the vaccine. it will make you good white christians sterile (or worse, have half-breed muslin babies).
Crab1: I think you need to hear this.
Crab1: FAIL!
Everyone, it’s time to panic. Watch CNN, and then totally freak out.
Visit http://doihavetheswineflu.com/ and await further instructions from your Muslin Overlords, who are now calling it H1N1(tm) because swine are dirty beasts (I learned that from Pulp Fiction).
Is that LIPSTICK?????
Rep. Barton’s revenge!!!
According to the WingNuts (and Glenn Beck), this whole Swine Flu thing is just something ginned up by the NoBama administration to scare people into buying into Socialist, Government Health Care. In which case, I applaud the Obama for being so committed to anti-freedom health care that they sacrificed a staff member and his family for the Socialist Fascist Cause
that swine-flu pig bears a striking resemblance to K-LO Goldberg.
Crab1:
Ha! I wrote about this last night about 3am, some chick wrote a song for the pig/bird flu! True! She is matching notes to the amino acids in the flu! They had audio and everything to it on Cnn. Screaming laughing! “Love Song For The Flu” WTF??????????????
http://www.cnn.com/2009/HEALTH/04/29/swine.flu.song.music/index.html
Hooray For Anything:
That’s it get the darn straight jackets out. I’ve had it with the lot of them.
Hooray For Anything:
The crazies are veering into Jerry Falwell aids loony territory. Not that they haven’t before. Well, at least 10 times a day. You think they would have learned after Spector left them in the dust. Don’t think Spector will be the first!
SOME PIG
TERRIFIC
RADIANT
HUMBLE
Sorry, I thought this thread was about Biden -
some right-wing retard i used to go to high school with is on facebook arguing with me that because obama isn’t reading right-wing blogs (e.g. http://corner.nationalreview.com/post/?q=YmM0MTAzMWQzYzIxMTZmMjc1MjBmNGUzMDIyYTVhZDM=) for feedback on how to handle the swine flu epidemic, he is hypocritical because he is breaking his promise to put science before policy.
never mind that the scientists at the CDC and the WHO are telling him “don’t close the borders”, those aren’t the RIGHT types of scientists. you know, the ones who don’t think evolution is real (I guess God had stored this flu virus in some ice cube underneath mexico waiting to be released)
Severna Park, eh? Well it’s better than Glen Burnie. I grew up in Hillsmere Shores, so Severna Park seems like the Riviera to me.
Crab1: I loved Ethan Hawke in that one.
Crab1: Correction.
5th line, 3rd G should be a T. But I don’t want to give the antidote away until my patent comes through in 2-3 years.
pat robertsons personal trainer: Sterile works for me.
Nerdalicious:
Sounds like the soundtrack for some David Lynch movie.
Next up….
Vocaloid Hatsune Miku sings Stephan Zielinski’s
“Swine Flu”
They SO need to do that!
Remember, its not PIG AIDS it MEXICAN AIDS. Now all you poindexrters figure out how it managed to jump from Mexicans to Humans.
http://www.christiananswers.net/spotlight/movies/discernment/hollywood-america.html
this article offers some very important clues as to why Obama decided to target Severna Park…
jgrn307: No, you moran, Jesus Intelligent-Designed the virus to smite, SMITE I say, the muslin terrist in the White House and the libruls who voted for him.
pat robertsons personal trainer: Bull! The vacine will implant an alien tracking device in your arm though.
Crab1: Yes, but what does it FEEL like?
Crab1: Hey that is the old H3N2 shit. The new shit H1N1 is cooler!
A/Texas/05/2009
1 atgaaggcaa tactagtagt tctgctatat acatttgcaa ccgcaaatgc agacacatta
61 tgtataggtt atcatgcgaa caattcaaca gacactgtag acacagtact agaaaagaat
121 gtaacagtaa cacactctgt taaccttcta gaagacaagc ataacgggaa actatgcaaa
181 ctaagagggg tagccccatt gcatttgggt aaatgtaaca ttgctggctg gatcctggga
241 aatccagagt gtgaatcact ctccacagca agctcatggt cctacattgt ggaaacatct
301 agttcagaca atggaacgtg ttacccagga gatttcatcg attatgagga gctaagagag
361 caattgagct cagtgtcatc atttgaaagg tttgagatat tccccaagac aagttcatgg
421 cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc ctcatgctgg agcaaaaagc
481 ttctacaaaa atttaatatg gctagttaaa aaaggaaatt catacccaaa gctcagcaaa
541 tcctacatta atgataaagg gaaagaagtc ctcgtgctat ggggcattca ccatccatct
601 actagtgctg accaacaaag tctctatcag aatgcagatg catatgtttt tgtggggtca
661 tcaagataca gcaagaagtt caagccggaa atagcaataa gacccaaagt gagggatcaa
721 gaagggagaa tgaactatta ctggacacta gtagagccgg gagacaaaat aacattcgaa
781 gcaactggaa atctagtggt accgagatat gcattcgcaa tggaaagaaa tgctggatct
841 ggtattatca tttcagatac accagtccac gattgcaata caacttgtca gacacccaag
901 ggtgctataa acaccagcct cccatttcag aatatacatc cgatcacaat tggaaaatgt
961 ccaaaatatg taaaaagcac aaaattgaga ctggccacag gattgaggaa tgtcccgtct
1021 attcaatcta gaggcctatt tggggccatt gccggtttca ttgaaggggg gtggacaggg
1081 atggtagatg gatggtacgg ttatcaccat caaaatgagc aggggtcagg atatgcagcc
1141 gacctgaaga gcacacagaa tgccattgac gaaattacta acaaagtaaa ttctgttatt
1201 gaaaagatga atacacagtt cacagcagta ggtaaagagt tcaaccacct ggaaaaaaga
1261 atagagaatt taaataaaaa agttgatgat ggtttcctgg acatttggac ttacaatgcc
1321 gaactgttgg ttctattgga aaatgaaaga actttggact accacgattc aaatgtgaag
1381 aacttatatg aaaaggtaag aagccagcta aaaaacaatg ccaaggaaat tggaaacggc
1441 tgctttgaat tttaccacaa atgcgataac acgtgcatgg aaagtgtcaa aaatgggact
1501 tatgactacc caaaatactc agaggaagca aaattaaaca gagaagaaat agatggggta
1561 aaactggaat caacaaggat ttaccagatt ttggcgatct attcaactgt cgccagttca
1621 ttggtactgg tagtctccct gggggcaatc agtttctgga tgtgctctaa tgggtctcta
1681 cagtgtagaa tatgtattta a
I could even even figger out which dead pile of bones in the Texas desert that came from…
(I work at NCBI/NLM/NIH doing software for the archives of all genetic stuff)
choinski:
It’s my personal opinion that Pat Sajak has no soul.
He traded it to the devil some 30 yrs ago in exchange for eternal
youth.
I’m 27 years old and that fucker hasn’t aged a DAY since I was born!
Either that or they have a successive series of Pat Sajak clones,
whereby this would be their 27th Iteration.
zenferret: Wait a minute - that looks like the part of the script of Reefer Madness where the dude is totally fried and laughing demonically.
Why is Lou Dobbs being so quiet on this?
This could have been prevented if Obama had just paid attention to his daily briefing entitled “Mexican Swine Flu Virus Determined to strike U.S.”
You guys, Severna Park is not nearly as awesome and cool as Yuzhna Park, you guys.
Pig Flu check:
http://www.doihavepigflu.com
Custerwolf: He’s not!:
Dobbs refers to people who use the term “H1N1″ as “out of their cotton pickin’ minds”
http://mediamatters.org/items/200904300015?f=h_top
zenferret: Try reading it aloud and you sound like a percussionist vocalizing.
Or someone getting waterboarded.
Nerdalicious: I had to share that with my cow-orkers. We see those sequences all day long as data.
Thanks.
WHAY ARE THEY LYING/111
Gibbs said the administration employee also was tested for the virus but the results were negative, likely because he had already recovered completely by the time he underwent the tests. He has returned to work, Gibbs said, and his relatives also suffered only mild symptoms and have regained their health.
Canmon (the Inadequate): Win.
Odds of 3-5 that this was all masterminded by Dick Cheney, and the cure for pig flu will magically appear when the POTUS next-in command is some junior undersecretary in the Agriculture Department, who happens also to be the lone conservative in the entire Obama administration. While you libtards have all been laughing at Cheney for the last eight years about his “undisclosed” location, he’s been holed-up in some top-secret bio-lab creating the pig virus and his masterful plan. Did you think he was gonna just sit back and let the country go Obama??? Jokes on you again libtards!
some poor kid in Cairo is crying his eyes out because this announcement came a day late and dollar short for his recently murdered best friend in the whole world, wilbur II.
http://www.chron.com/disp/story.mpl/ap/world/6401547.html
in kinda seriousness, wtf WHO? people already really like to kill pigs. don’t make it harder on the non-pork product piggies who are doing nothing wrong by naming a “shit-yourself-with-fear” disease after the poor little bastards.
Custerwolf: Nerdalicious: So far as waiting out the oncoming crash of civilization may I suggest:
Hanson Island, British Columbia
http://www.privateislandsonline.com/bchanson.htm
zenferret: Tell your bosses to give us more R01’s, dammit.
When is this flu going to get on a motorcycle and ride off to Alaska? The residents of Wasilla are eager to pass it around to each other. Then they will freeze it so it will last forever.
One Yield Regular: I’m bottom rung contract software engineer. My bosses barely know I’m alive. No one who has anything to do with R01s knows me.
But that shiny new Democrat / creaky old republican got us more moneys in teh stimulus. Maybe they’ll give some to you.
As long as they keep giving some to me I’m happy. Well happier than if they didn’t.
Jukesgrrl: piggy virus on meth.
choinski: How do we know those catlick school kids didn’t give it to the Mexicans? Don’t wait for a punchline.
Severna Park? Really? What a co-inkydinky. That’s the name of my Hungarian-Korean dominatrix.
choinski: wrong.
This is officially the ‘Smithfield Swine Flue”
Corporate sponsorship is important you know.
http://www.guardian.co.uk/world/2009/apr/27/swine-flue-search-outbreak-source
Johnny Zhivago: “Swine flu! Look, Muffy, a flu for us!”
chascates:
Kewl! Does Brangelina hang out there? Let’s go after our flu trip to NYC!
zenferret:
Ha! I think that just might be the wackiest thing to come out of this yet, that Flu Song.
Czn939:
Yeah David Lynch, do the amino acids talk backwards????????
Ok, I wrote this late last night about the Flu Song:
“Pig/Bird Flu, How Do I Love Thee, May I Count The Ways”
“The breadth & depth, of your untamed cells furrowing into my marrow.
How I wish I could quit you with a vaccine.
But, nay there is none, only thee
And even the Prez said I have to wash my hands of you.
I weep.
The only respite is Tammy Flu.
But, I want you.
Waterfalls of tears
And nasal mucous.
Fini.”
I find this as amusing as when all those aortic valves of famous people just went Pffffft all at once, Babs Bush, Robin Williams and some baseball player. Soylent Green is aortic valves!
snideinplainsight: awwww.
WadISay:
Good One!Ok everyone! Flu Song Contest! Yearrrrrrrrrgggggghhhhhh!
Custerwolf: You know what that’s a damn good question.
Lucifer Dobbs is obviously the epicenter of this entire Agent 666/HNIC Virus debacle.
Custerwolf: He has sequesterd himself in his dressing room which he has sealed off with duck and cover tape and insaranity wrap and won’t come out.
Custerwolf: The hyper-revealing tell! Dobbs is the litmus test. One smelleth le odeur du swine in the business ointment.
zenferret: Crab1 also.
Single letter amino acid code please. You guys are so CSH Guide to Molecular Biology Version 1.
zenferret: “piggy virus on meth” I think I was in a band once that had that name.
Hey! That’s, like, down the road from me!
*Starts stockpiling food.*
Hopey is, in reality, the dreaded Patient Zero! He’ll give all of us that muslin pig virus if he’s not stopped!
sux2bu:
Believe me that will be the next Rethug angle! Then they will lose another Spector & it will be a domino effect. Bachman, Palin, & Limbaugh will be like “Lost” survivors.
From the article “”"Neither the president nor Chu experienced any symptoms of the virus, Gibbs said, and White House doctors do not think Obama should be tested. “”" CONSPIRACY!!! Are they afraid the swine flu test will also reveal the fake prenzidnet’s bogus somalie origin? If he doesn’t have the pig flu why is he so afraid to take the test?
zenferret: Well thanks anyway. Actually, everyone I know in science is pretty happy about the monies at the moment, especially after the past 8 of fundamentalism.
Uh…8 YEARS. Sorry.
zenferret: Set sequencers on stun.
he gets weekly injections of plasma directly from Dick Clark.